quote:I said earlier in the thread that I had read somewhere that sometimes something is a tautology because it is self-evidently true. This would be an example.
Originally posted by MightyCow:
Humans need to breathe air to survive, therefore, it is only humans who can successfully breathe who are able to survive.
Well, obviously that's a tautology, and therefore untrue and completely worthless in understanding human biology or survival.![]()
quote:Natural selection ALSO says that the individuals that survive will pass on their genes to their offspring who will also be subject to the same selective pressures. Over time this process will tend to increase the representation of the "more fit" genes in the population.
Therefore, if the species survives, it is fittest, and it is fittest if it survives.
quote:No, it doesn't. If we always observed that all varaints in a population always survived equally well, then we would not conclude natural selection.
Originally posted by Reshpeckobiggle:
Natural selection is true based upon it's own premises, because one premise implies the other.
quote:You don't understand how evolution works within a populaiton of the same species. No one thinks that you have a handle on what it has to say about competition between species.
The definition of "the fittest" as pertains to Evolutionary theory is the the species that is most likely to reproduce.
quote:The fittest memebrs of a population are by definition the ones that reproduce the best. If certain variants don't reproduce any better than others, than we don't call them the fittest.
I suppose it could be rendered false if it were determined that the fittest creatures are not necessarily the ones most likely to survive and reproduce, bot a lot of good that would do Evolutionary theory.
quote:Sure it does. Your proposed tautological statement of natural selection says nothing about the transmission of genes. When you include enough information to fully describe the theory, it becomes much harder to formulate a tautological statement of the theory. It's not impossible though, because you can describe any theory as a tautology if you include the observations and inferences of the theory in the statement.
That's not adding anything to the equation, Matt.
quote:Sigh.
Originally posted by Reshpeckobiggle: The individual belongs to a species. The species is more likely to survive if the individual members of its group are sufficiently fit to pass on their genetic information.
quote:No. We conclude that a particular allele is probably making its bearers more fit if we observe that the allele is growing in frequency in the population. (Neutral alleles can grow in popualtions due to random chance, or being physically linked to benefical alleles)
[Edit} I didn't really answer your question. Ok, if an individual within a species is more fit than the others within the species, then its genes will have greater representation within the species. Now we're getting somewhere. [/qb]
quote:Natural selection explains the progression of the allele pools of populations. Individuals which are more successful will have a larger influence on the allele pool than individuals which are less successful. Over time, alleles that grant the best chance of reproduction will become more common in the allele pool of the population.
Natural selection is the process by which favorable traits that are heritable become more common in successive generations of a population of reproducing organisms, and unfavorable traits that are heritable become less common.
quote:Natural selection is the fitness function. Without natural selection there would be no way for a species to adapt to its environment. The random mutations introduced in one generation would have no influence on the next. The genetic makeup of the population would stay virtually identical. Natural selection is function that permits the adaptation of species. The random mutations in one generation may have a decidedly non-random impact on the reproductive capabilities of an individual. This non-randomness allows beneficial mutations to spread throughout the population over time because the individuals with those mutations will reproduce more often than those without them. Without this fitness function, species could not adapt at all. Darwin's finches would never exist.
Originally posted by Reshpeckobiggle:
This would have to be something like a specific increased function that gives an advantage to a species, or an individual [edit] within the [/end edit] species.
quote:No, it doesn't. You aren't such a victim as you keep making yourself out to be.
Originally posted by Reshpeckobiggle:
Paul, the main thrust of the arguments about how I do not understand Evolution usually turn on the fact that I don't believe it to be true.
quote:I don't see a circularity. I see two ways of saying the same thing. Natural selection is pretty self-explanatory. All it requires to work is that different individuals in a population have different chances of reproduction (in this case caused by genetic differences between individuals). Those different chances of reproduction are what lead to changes in the overall genetic composition of a population.
Originally posted by Reshpeckobiggle:
Is there a major difference between saying that and saying: " The species is more likely to survive if the individual members of its group are sufficiently fit to pass on their genetic information. Their fitness is rated according to how well they pass on their genes... if an individual within a species is more fit than the others within the species, then its genes will have greater representation within the species.
quote:And if the type of seeds change so as to favor large beaks then the large beak finches will eventually dominate the population (and become the new "norm"). That's natural selection.
Originally posted by Reshpeckobiggle:
If a population of finches just keeps on reproducing with no variation in the environment, you'll get finches with a mean and median beak size, and then a few with beaks at the extreme ends of the size spectrum. All this without a single mutation necessary.
quote:Absolutely. Verifiable, acceptable, no argument there. But as an indication of natural selection's conservative tendencies, when the environment changed back, the average beak size returned to normal (this actually happened.)
And if the type of seeds change so as to favor large beaks then the large beak finches will eventually dominate the population (and become the new "norm"). That's natural selection.
quote:Yes, there is a difference. The top quote is only talking about individuals changing the allele pool of a population, the second is talking about the survival of species.
Originally posted by Reshpeckobiggle:
Isn't that basically what I've been saying, Threads?
"Individuals which are more successful will have a larger influence on the allele pool than individuals which are less successful. Over time, alleles that grant the best chance of reproduction will become more common in the allele pool of the population."
Is there a major difference between saying that and saying: " The species is more likely to survive if the individual members of its group are sufficiently fit to pass on their genetic information. Their fitness is rated according to how well they pass on their genes... if an individual within a species is more fit than the others within the species, then its genes will have greater representation within the species.
quote:Really, why don't you show us?
Originally posted by Reshpeckobiggle:
[QB] Holy cow, this may be where the disconnect lies! Natural selection doesn't simply work on the mutations, it works on the variation within a species. The finches have encoded into their DNA a certain amount of variability in the size of their beaks.[QB]
quote:No kidding. You're telling me you didn't understand that? No wonder you're confused- that's the basic postulate upon which the theory rests!
Originally posted by Reshpeckobiggle:
Holy cow, this may be where the disconnect lies! Natural selection doesn't simply work on the mutations, it works on the variation within a species.
quote:Where do you think that variability came from in the first place? Hint: it starts with "M" and rhymes with "plantation."
The finches have encoded into their DNA a certain amount of variability in the size of their beaks. No mutations are needed.
quote:Sort of. If certain phenotype(s) are advantageous in your hypothetical constant environment, then they will tend to sweep to fixation (that is, they will eventually dominate the population until they are the only alleles present). How long fixation takes depends on how much more fitness they confer relative to the other alleles in the population.
If a population of finches just keeps on reproducing with no variation in the environment, you'll get finches with a mean and median beak size, and then a few with beaks at the extreme ends of the size spectrum. All this without a single mutation necessary. [/QB]
quote:Yes, which only goes to show that evolution doesn't follow some grand master plan- that what is "better" at some particular place and at some point in time won't necessarily be "better" anywhere or anywhen else. It also doesn't mean that evolution will inevitably cause populations to return to some ancestral state, if that is what you're implying. Natural selection has no memory- it only acts on the here and now.
Absolutely. Verifiable, acceptable, no argument there. But as an indication of natural selection's conservative tendencies, when the environment changed back, the average beak size returned to normal (this actually happened.)
quote:"Macroevolution" is just the logical consequence of "microevolution" over a very long period of time. Lots of things can lead two formerly interbreeding populations to stop interbreeding, and once they stop, they aren't likely to start again. Eventually, some genetic change will occur that eliminates inter-population fertility altogether, such as a chromosome duplication or fusion. Yes, contrary to your preconceived notions, there are events that can very rapidly lead to speciation. Of course, when I say "very rapidly," I'm still talking in the order of thousands of years. But it's quicker than millions.
Originally posted by Reshpeckobiggle:
You are describing a subtle change where one type of fish very gradually evolves into a very similar fish with different capabilities and strengths. That is Micromutation, and something that I have repeatedly said I don't have a problem with. It may be considered a different species depending on what changes occur and even how species is being defined at the time.
quote:Of course it is. It demonstrates how small changes can build up over time, which is a central prediction of evolutionary theory. When lots of small changes build up, you get large changes. It's as simple as that.
When I say that there is no evidence for Evolution (notice the capital "e"), what I mean is that Isaying that this type of micromutation can conceivably account for the eventual changes of fish into amphibians, I do not think that is evidence.
quote:You've got to be kidding. swbarnes is being very polite- he's just demanding that you put up or shut up. The only one here losing his cool is you.
[edit] Nevermind. I gave you a chance. I'm ignoring your posts from now on. [/QB]
quote:The universe does not care about what you personally can or can't conceive of. No one here does, we care about what the evidence shows.
Originally posted by Reshpeckobiggle:
You are describing a subtle change where one type of fish very gradually evolves into a very similar fish with different capabilities and strengths. That is Micromutation, and something that I have repeatedly said I don't have a problem with. It may be considered a different species depending on what changes occur and even how species is being defined at the time
When I say that there is no evidence for Evolution (notice the capital "e"), what I mean is that Isaying that this type of micromutation can conceivably account for the eventual changes of fish into amphibians, I do not think that is evidence.
quote:Yeah, I made the cardinal error of asking you to back up your make-believe with evidence from Ensembl, and now you are pouty. How predictable.
Nevermind. I gave you a chance. I'm ignoring your posts from now on.
quote:Thanks Ron, but that's not true of everybody. I am really hoping that if I ignore the bad apples and only engage those like Threads and Matt, and a few others from the other thread like fugu and sumnion, that this will be a very pleasant conversation, and maybe we can all learn something.
Originally posted by Ron Lambert:
I applaud your efforts, Reshpeckobiggle. But I think you are probably wasting your time. The pro-evolutionist lobby here is utterly wedded to the notion that only someone who is ignorant could refuse to accept evolution. When someone comes along and shows that he is not at all ignorant, and knows all the facts that they do, and still does not accept evolution, that really gores their ox. When you cite facts that are clearly inconvenient for their cherished theory, they can get mean, nasty. Rabid. And they accuse you of doing all the screaming and yelling, when it is really them. At least, that has been my experience with them. Good luck.
quote:*faceplant*
Originally posted by Reshpeckobiggle:
Ok, Tarrsk, lets tackle this. Are you saying that any change in DNA between the parent and offspring is a mutation?
quote:From wiki: In biology, mutations are changes to the base pair sequence of the genetic material of an organism. Mutations can be caused by copying errors in the genetic material during cell division, by exposure to ultraviolet or ionizing radiation, chemical mutagens, or viruses, or can occur deliberately under cellular control during processes such as hypermutation.
Originally posted by Tarrsk:
quote:*faceplant*
Originally posted by Reshpeckobiggle:
Ok, Tarrsk, lets tackle this. Are you saying that any change in DNA between the parent and offspring is a mutation?
Yes. Of course. That's the definition of mutation!
quote:Hah. Fair enough, you got me there. I forgot about recombination, which is when you get a bit of something from Mom and a bit of something from Dad. That doesn't change the fact that for Mom and Dad to be different in the first place, mutation must have occurred at some point. Otherwise, there would be no variation in the population at all- everyone would be a clone. And if that's true, then it doesn't matter what you get from Mom or Dad, because the end product (your genotype) will always be the same.
Originally posted by Reshpeckobiggle:
quote:From wiki: In biology, mutations are changes to the base pair sequence of the genetic material of an organism. Mutations can be caused by copying errors in the genetic material during cell division, by exposure to ultraviolet or ionizing radiation, chemical mutagens, or viruses, or can occur deliberately under cellular control during processes such as hypermutation.
Originally posted by Tarrsk:
quote:*faceplant*
Originally posted by Reshpeckobiggle:
Ok, Tarrsk, lets tackle this. Are you saying that any change in DNA between the parent and offspring is a mutation?
Yes. Of course. That's the definition of mutation!
This is something quite different from the differences acquired by taking half your DNA from one parent and half your DNA from a different parent.
quote:Sigh.
Originally posted by Reshpeckobiggle:
That's a premise I don't just blindly accept. Mutation may be the sole source of differences, but it may be because Adam and Eve were created with two different yet compatible sets of DNA, and all the male/female pairs on the Ark had different yet compatible sets of DNA.
quote:
In all seriousness and no snideness intended - there's no trap, mate. There's just evidence. You make claims, they make claims and everyone provides evidence to back up their claims.
No-one's trying to trap you - even when we've been snide, we're genuinely interested in the evidence you do have and your interpretations of the evidence we provide.
quote:I'm including you in my invitation, but the key here is civility. You could have left out that little "sigh." Until you do, I'm ignoring you.
Originally posted by swbarnes2:
quote:Sigh.
Originally posted by Reshpeckobiggle:
That's a premise I don't just blindly accept. Mutation may be the sole source of differences, but it may be because Adam and Eve were created with two different yet compatible sets of DNA, and all the male/female pairs on the Ark had different yet compatible sets of DNA.
There are some loci in the human genome with more than a hundred alleles.
How do you propose that two, or even eight people carried all those alleles?
quote:Resh, I think this sentence, in a nutshell, helps to explain why so many people who know more about science -- and the scientific method -- than you do get frustrated with your argument. Do you understand why that sentence is ridiculous?
"the person died because the flow of oxygen to his lings was cut off" actually does not have explanatory power.
quote:There is nowhere near enough variation within the genotypes of two individual humans to account for the vast array of phenotypes we see in humans today. Even if Adam and Eve were each heterozygous at every single locus for different alleles (i.e. 4 alleles per locus), that wouldn't be anywhere near enough. Without mutation, your model implies that for any given gene, there are can be at MOST four different alleles. We know of individual loci with hundreds of alleles all by themselves. It is physically impossible for all of that variation to have come into being without some sort of mutation occurring.
Originally posted by Reshpeckobiggle:
That's a premise I don't just blindly accept. Mutation may be the sole source of differences, but it may be because Adam and Eve were created with two different yet compatible sets of DNA, and all the male/female pairs on the Ark had different yet compatible sets of DNA.
quote:That's because you neither understand evolution nor have knowledge of the evidence. Both are readily corrected, but you have thus far proven unwilling.
I'm not saying that this is what happened, by the way. But I find it more likely to have happened than Evolution. [/qb]
quote:I know that. First let me say that I do not subscribe to the notion that I can only discount the validity of Evolution if I have a viable theory that can replace it. Even so, I'm just going to say that I don't think mutations don't happen. This is the argument that is put out by Creationists: that the original two human DNA pairs were perfect, without any flaws. Therefore their children were born with perfect DNA, and so they could interbreed without worry about deformities. However, after the Flood the firmament which blocked so much of the harmful rays of the sun fell, and mutations began occurring with some frequency. One consequence that the Bible describes and might have been predicted by a theory based upon Creation-science is that within a few generations life spans would have been severely reduced, from thousands of years to no more than 120 or so.
Originally posted by fugu13:
Resh: It isn't possible for two humans to have all the variation we see in the human species entirely in their genomes. There are more gene variations than there are places to put them.
quote:No, and if you have to ask then you should already have known.
Originally posted by Tarrsk:
quote:That's because you neither understand evolution nor have knowledge of the evidence. Both are readily corrected, but you have thus far proven unwilling.
I'm not saying that this is what happened, by the way. But I find it more likely to have happened than Evolution.
Oh. Was that not civil enough for you?[/QB]
quote:Someone said that without mutations, we'd all be clones. You countered by stating that perhaps all of the variation for creating the diversity we see in humans today was part of Adam and Eve's DNA. Now it seems that you're agreeing with the original statement that mutations must have occurred.
Again, I'm not saying I think this is what happened, but I'm not ruling it or something similar from happening.
quote:Maybe, but I'm not sure how much leeway I can allow, considering how quickly things degrade. I mean, it's already happening, even with you. I don't want to hear that I made "blind assertions that are indisputably impossible and propose that they are the most likely explanation." First off, I didn't say it was the most likely, I just said I find it more likely, by simple virtue of the fact that I find Evolution to be nigh impossible. Second, don't just tell me something is indisputably impossible, tell me why you think so.
Originally posted by MattP:
Resh, you need to get off the hair trigger. People are willing to answer your questions, but when you make blind assertions that are indisputably impossible and propose that they are the most likely explanation, then you might just get a *sigh* or two in response.
quote:You were told by a couple different people. You just weren't happy with their attitude.
Second, don't just tell me something is indisputably impossible, tell me why you think so.
quote:That's because you've got it wrong. I wasn't countering the fact that mutations occur, I was countering the notion that only through mutations may variations arise. I've said this before: I think it may be possible that there were many different kinds of animals and because of mutations all those different kinds have devolved into all the very specialized species. Like, there used to be only one kind of sqirrel, and now all the different types of squirrels out there came from them.
Originally posted by MattP:
quote:Someone said that without mutations, we'd all be clones. You countered by stating that perhaps all of the variation for creating the diversity we see in humans today was part of Adam and Eve's DNA. Now it seems that you're agreeing with the original statement that mutations must have occurred.
Again, I'm not saying I think this is what happened, but I'm not ruling it or something similar from happening.
I find this very confusing.
quote:No, come on, don't do that. We just need to stay focussed, and this sort of thing is distracting. You'll notice that when someone told me why it was impossible, I addressed the problem.
Originally posted by MattP:
quote:You were told by a couple different people. You just weren't happy with their attitude.
Second, don't just tell me something is indisputably impossible, tell me why you think so.
I'll stay off the thread to avoid making any further comments that you might interpret as uncivil.
quote:If people seem hostile, that's entirely because of your own attitude. Perhaps you should pull out that giant honkin' log in your eye before you start tweaking others about the splinters in theirs?
Originally posted by Reshpeckobiggle:
quote:Maybe, but I'm not sure how much leeway I can allow, considering how quickly things degrade. I mean, it's already happening, even with you.
Originally posted by MattP:
Resh, you need to get off the hair trigger. People are willing to answer your questions, but when you make blind assertions that are indisputably impossible and propose that they are the most likely explanation, then you might just get a *sigh* or two in response.
quote:If that is what you did, how is it "uncivil" to point it out?
I don't want to hear that I made "blind assertions that are indisputably impossible and propose that they are the most likely explanation."
quote:That's exactly what people have been doing. You just choose to imagine some sort of intended offense against your delicate disposition rather than address the substance of our responses. swbarnes, for example, has addressed virtually every one of your points in both this thread and the last one, only to be shot down with a simple "la la la I'm not listening because you're so MEAN!"
First off, I didn't say it was the most likely, I just said I find it more likely, by simple virtue of the fact that I find Evolution to be nigh impossible. Second, don't just tell me something is indisputably impossible, tell me why you think so. [/QB]
quote:Resh, you are insulted when people call you wrong. In cases like this, in which you're manifestly wrong, it is impossible to communicate the reality of the situation to you without insulting you.
I'm just not responding to posts that are intentionally insulting.
quote:I have to admit, I don't really give a damn whether you personally think I'm being uncivil. I think I'm being perfectly civil, as are swbarnes and MattP, and I suspect that other people reading this thread (including the mods) would concur. Nobody has done the internet equivalent of raising their voices here. We just don't see any point in sugar-coating our phrases, especially when doing so would actually obscure what we are trying to say.
Originally posted by Reshpeckobiggle:
Tarrsk, that's exactly what fugu did, telling me why he thought I was wrong and he was the one who got an answer from me, even though you and swbarnes made essentially the same point. On the last thread I was enjoying the conversation with him, Matt, suminon, and some of the others. But a few of the others (not you then, but you now) were ruining the experience. I don't have delicate sensibilities, I just don't feel like wasting my time, which is what I'm doing now.
quote:Again, nobody is being intentionally insulting. Some of us are exasperated, sure, but if that's enough to turn you into Little Miss Junior Mod, then that's your own lookout, not ours.
I'm not officially ignoring anybody, I'm just not responding to posts that are intentionally insulting.[/QB]
quote:Exactly my point, but better stated. Thanks, Tom.
Originally posted by TomDavidson:
Resh, you are insulted when people call you wrong. In cases like this, in which you're manifestly wrong, it is impossible to communicate the reality of the situation to you without insulting you.
quote:Tom, I'm not insulted when people call me wrong, though I would prefer that people say that my belief or understanding is wrong. I only have a problem when people just come out and tell me I'm wrong without bothering to explain why. This is why it seems to be, however erroneously) that Evolutionists seem to believe that doubting the theory automatically implies ignorance.
Originally posted by TomDavidson:
quote:Resh, you are insulted when people call you wrong. In cases like this, in which you're manifestly wrong, it is impossible to communicate the reality of the situation to you without insulting you.
I'm just not responding to posts that are intentionally insulting.
quote:
Originally posted by King of Men:
What if they gave an evolution thread, and nobody came?
quote:
Originally posted by King of Men:
All we're sayin' is, give shuttin' up a chance!
quote:
Originally posted by King of Men:
Hell no, we won't post!
quote:
Originally posted by King of Men:
This thread is a quagmire. I think we should pull out all our posters from it right now.
quote:This may be a sign of the apocalypse, but I agree with every post of KoM's in this thread so far.
Originally posted by King of Men:
No blood for debate! Posters home now!
quote:Sure, I'd be happy to. Of course, it does require you to stop whining about how people are being "uncivil." Can you do that?
Originally posted by Reshpeckobiggle:
Okay Tarrsk, but have you noticed that because of all this (everyone being insulting, me being hypersensitive, or whatever combination of the two), we aren't talking about Evolution? Seriously, I'm just asking that people stay focused and avoid name-calling, unfounded assumptions about the other person's motive, condescending language, that sort of thing. Can we agree on that?
quote:I like how you plead that we on the other side get back on-topic, and then continue to perpetuate the off-topicness yourself. Way to lead by example!
I disagree with you that you have-to sugarcoat anything in order to be civil, not if you stick to talking about the theories and ideas that get thrown about. Refraining from saying things like "Little Miss Junior Mod" is not going to hurt your ability to defend the theory of evolution. [/QB]
quote:This is untrue. This is, in fact, blatantly untrue. While the statement does not provide a full and detailed explanation of all the various mechanisms that produce death, it is otherwise an accurate explanation of death: the person died because the flow of oxygen to his lungs was cut off. We can investigate why his lungs were deprived of oxygen; we can investigate why people require oxygen. But that's not necessary for the statement you quoted to, in and of itself, to have some explanatory power.
"the person died because the flow of oxygen to his lungs was cut off" actually does not have explanatory power.
quote:I would say that "fully-developed" could describe a great many things. For instance, one might consider a penguins wing fully developed even though it doesn't confer upon the bird the ability to fly. On the other hand, if you consider all species as being in a transitional state, then an eagle's wing might not be fully developed.
Originally posted by 0Megabyte (elsewhere):
" All life forms are found with fully developed features"
Define "fully developed" features. How would you tell if a feature was partly developed or fully developed in the first place? Further, you are holding these things as fully or incompletely developed compared to what standard?
quote:Fine, then focus.
Originally posted by Reshpeckobiggle:
We just need to stay focussed, and this sort of thing is distracting. You'll notice that when someone told me why it was impossible, I addressed the problem.
quote:Furthermore, as has already been pointed out here and elsewhere, even if the fossil record didn't exist, there is more than enough genetic data at this point to fully support evolutionary theory by itself. The fact that the fossil record also supports evolution (along with every other field in biology) is just delicious creamy icing on the phylogenetic cake.
Originally posted by Threads:
It's silly to expect us to find transitional fossils for every single transitional creature that could have existed. Fossils only form under specific conditions and are prone to being destroyed by natural events. In the previous thread I provided a link to a page that cited hundreds of different transitional species that have been found.
quote:Willful misinterpretation of what I said? I didn't say I believed that is what happened. I just said that I haven't ruled it out as a possibility. And with my limited technical knowledge of genetics, I still haven't. You're insisting that I go and do something that I can't do, because I don't have the training required to do it. Somehow this is supposed to show that I have no right to doubt the theory of Evolution.
Originally posted by swbarnes2:
You said that you believed a genome contains all the information it needs to generate a wide variety of phenotypes.
Well, you've got a whole genomes for a fair number of organisms at your fingertips. Human, mouse, rat, dog, zebrafish...etc.
So pick one varying trait, like fur color in mice, and show us in the genome of C57L/B6 where all the information for all the other fur colors are kept.
It's all right here. So focus, and show us.
www.ensembl.org
Or admit that you can't find any evidence to support your supposition.
quote:Of course it does. Do you really think that expertise means nothing? If there was a thread on the engineering of spaceflight-capable rockets, would it be intellectually valid for someone who never got through high-school geometry to wander in and casually dismiss everything being said because he can't understand calculus?
Originally posted by Reshpeckobiggle:
quote:Willful misinterpretation of what I said? I didn't say I believed that is what happened. I just said that I haven't ruled it out as a possibility. And with my limited technical knowledge of genetics, I still haven't. You're insisting that I go and do something that I can't do, because I don't have the training required to do it. Somehow this is supposed to show that I have no right to doubt the theory of Evolution.
Originally posted by swbarnes2:
You said that you believed a genome contains all the information it needs to generate a wide variety of phenotypes.
Well, you've got a whole genomes for a fair number of organisms at your fingertips. Human, mouse, rat, dog, zebrafish...etc.
So pick one varying trait, like fur color in mice, and show us in the genome of C57L/B6 where all the information for all the other fur colors are kept.
It's all right here. So focus, and show us.
www.ensembl.org
Or admit that you can't find any evidence to support your supposition.
quote:I'm not sure you what you mean by "conceptualizations". That is not a term that commonly used in science.
How much of the evidence for evolution is actually just conceptualizations, and not actual empirical evidence?
quote:That image was faked. Therefore Evolution is false.
Originally posted by MrSquicky:
I'm disappointed that you haven't seen fit to address the video I saw of a dog wearing scuba gear. I mean, I get that the example I gave of how macro-evolution can be demonstrated through the fossil record of a land mammal evolving into proto-whales didn't fit your criteria, but, for Pete's sake, that dog was wearing scuba gear!
---
edit: Here's irrefutable proof that evolution is real. I defy you to tell me that dog isn't wearing diving equipment.
quote:It seems to me that if your faith is shaken by some simple facts, then it's not a terribly strong faith. But I'll leave you to figure that out, it's not really my business.
Originally posted by Reshpeckobiggle:
I'm sorry, MrSquicky. I actually want to see that. I'll report back soon.
A valid point, swbarnes. The difference is that rockets don't imply a negation of ones religious beliefs (not that Evolution necessarily does, but it sure seems to; ruling out the need for a Creator pretty much rules out the possibility of a Creator for a skeptic.)
quote:Hate to break it to you, but being simple enough for a non-advanced degree holder to understand is not a prerequisite for something to be true. It is indisputable that rockets have been designed that can reach escape velocity and enter orbit around the Earth. You and I might understand the basic physics of motion, but there is certainly plenty about rocket design that we do not understand- the chemistry of the fuel, the complex aerodynamics that minimize drag from air. Are you saying that the rocket would still be able to fly without its designers knowing these things?
Moreover, they don't imply that I must ignore some very basic concepts that I can reasonably hold without an advanced degree.
quote:How about virtually every single medication produced in the last twenty years? Those gene sequence databases which you so casually dismissed in the previous thread have been critical to the development of modern biotechnology. Molecular phylogenies allow us to target genes that are evolutionarily conserved between humans and mice, so that we can test new therapies in the mice before moving into human subjects. If evolutionary theory wasn't true, then this approach would be fundamentally flawed, and we should be seeing the majority of human tests fail miserably as drugs that did the trick in mice either do nothing in humans or are actively deleterious. This does not happen.
Not only that, but you can show me what rockets can do, but you can't show me what Evolution can do (beyond varying beak sizes and moth colorings.)
quote:Someone's edging dangerously close to the thermodynamics fallacy again. There is nothing inherently impossible about complexity arising from disorder, so long as there exists a source of free energy to power it. Which we do- the sun.
Instead, you are trying to convince me that all this came from chaos based on some natural law that says random matter has some self-ordering properties to the degree of creating the most inconceivably complex structures ever known. [/QB]
quote:*blink* It seems to me that they're answers to the questions "why did life evolve" and "how did he die," actually. Why don't you think they answer those questions?
Saying that humans need oxygen to live, and so humans without oxygen do not live is the equivalent to natural selection. Saying this person died because oxygen was cut of is the equivalent to Life evolved because of natural selection. Neither are really an explanation of anything.
quote:So you concede that we have a) a range of complexity in eye types and b) a requirement by the theory that this complexity must exist. What else do you need?
This is not to say it didn't happen, just that it can't be shown that it did aside from a range of complexity in eye types and a requirement by the theory that says it must have.
quote:Yeah, it was a set of three papers I was reading for one of my classes. Unfortunately, I'm not sure they're available for free online unless you're at a university that has paid for access to the journals, but here are the citations if you want to try to find them:
Originally posted by 0Megabyte:
Tarssk. I'd love to see that information about that cancer drug. You said you read it last night? Where? I want to see!
quote:Like I said, they are only superficial answers. Look at it like this: How did he die? Lack of oxygen. Why did that kill him? Ooooh... that's a bit more complicated.
Originally posted by TomDavidson:
quote:*blink* It seems to me that they're answers to the questions "why did life evolve" and "how did he die," actually. Why don't you think they answer those questions?
Saying that humans need oxygen to live, and so humans without oxygen do not live is the equivalent to natural selection. Saying this person died because oxygen was cut of is the equivalent to Life evolved because of natural selection. Neither are really an explanation of anything.
quote:Nothing, if you already believe the theory in the first place. I should add to that though, that the range of eye types that we have are a small fraction of the eye types required by the theory.
quote:So you concede that we have a) a range of complexity in eye types and b) a requirement by the theory that this complexity must exist. What else do you need?
This is not to say it didn't happen, just that it can't be shown that it did aside from a range of complexity in eye types and a requirement by the theory that says it must have.
quote:Evolution of the eye in Wikipedia shows examples of organisms that exhibit many of the step proposed for evolution of the eye.
Originally posted by Reshpeckobiggle:
By conceptualizations, I mean stories about how all sorts of developments occurred based upon the necessity of them occurring. For instance, we all know the different stages of evolution that they human eye had to go through in order to get to its current level of development. But how many of those stages are implied by the necessity of their existence, and not because we've actually seen proof of their existence?
quote:
Originally posted by Reshpeckobiggle:
Willful misinterpretation of what I said? I didn't say I believed that is what happened. I just said that I haven't ruled it out as a possibility.
quote:If you can't stand the heat, get out of the kitchen.
And with my limited technical knowledge of genetics, I still haven't. You're insisting that I go and do something that I can't do, because I don't have the training required to do it.
quote:You have all the right in the world to doubt whatever you want. And we have every right to point out that your claims are laughably false, and often ridiculously stupid.
Somehow this is supposed to show that I have no right to doubt the theory of Evolution.
quote:It depends on what you are trying to explain, really. The over-simplified example of oxygen isn't useless if what you are trying to explain is why someone dies when submerged in water, or why someone dies when their airway is blocked.
Originally posted by Reshpeckobiggle:
The tautology about oxygen is just a useless. "the person died because the flow of oxygen to his lings was cut off" actually does not have explanatory power. It doesn't explain why humans need oxygen, or why the oxygen source was cut off. You actually need to have some sort of explanation about how oxygen is used by the body, and what happens when it is cut off. That tautology explains why the person died just as accurately as Natural Selection explains how we evolved, which is to say, it doesn't.
quote:They're superficial answers, yes. But they are not uninformative answers. Neither are they tautologies.
Like I said, they are only superficial answers. Look at it like this: How did he die? Lack of oxygen. Why did that kill him? Ooooh... that's a bit more complicated.
quote:If it helps, as someone that theoretically has the technical knowledge, I couldn't do that. You need to get several mice to actually get the full range of alleles.
Originally posted by Reshpeckobiggle:
quote:Willful misinterpretation of what I said? I didn't say I believed that is what happened. I just said that I haven't ruled it out as a possibility. And with my limited technical knowledge of genetics, I still haven't. You're insisting that I go and do something that I can't do, because I don't have the training required to do it. Somehow this is supposed to show that I have no right to doubt the theory of Evolution.
Originally posted by swbarnes2:
You said that you believed a genome contains all the information it needs to generate a wide variety of phenotypes.
Well, you've got a whole genomes for a fair number of organisms at your fingertips. Human, mouse, rat, dog, zebrafish...etc.
So pick one varying trait, like fur color in mice, and show us in the genome of C57L/B6 where all the information for all the other fur colors are kept.
It's all right here. So focus, and show us.
www.ensembl.org
Or admit that you can't find any evidence to support your supposition.
quote:I realized on rereading that Resh's constant flip-flopping between talking about natural selection working on individuals and it working on species cause me to misread his argument. What he wrote was
Originally posted by scholar:
quote:If it helps, as someone that theoretically has the technical knowledge, I couldn't do that. You need to get several mice to actually get the full range of alleles.
Originally posted by Reshpeckobiggle:
quote:Willful misinterpretation of what I said? I didn't say I believed that is what happened. I just said that I haven't ruled it out as a possibility. And with my limited technical knowledge of genetics, I still haven't. You're insisting that I go and do something that I can't do, because I don't have the training required to do it. Somehow this is supposed to show that I have no right to doubt the theory of Evolution.
Originally posted by swbarnes2:
You said that you believed a genome contains all the information it needs to generate a wide variety of phenotypes.
Well, you've got a whole genomes for a fair number of organisms at your fingertips. Human, mouse, rat, dog, zebrafish...etc.
So pick one varying trait, like fur color in mice, and show us in the genome of C57L/B6 where all the information for all the other fur colors are kept.
It's all right here. So focus, and show us.
www.ensembl.org
Or admit that you can't find any evidence to support your supposition.
quote:I'm glad I wasn't the only person to misread that comment. I actually felt a bit silly about it. But it was ambiguous, and front-loading is a Creationist idea, so it wasn't absolutely crazy that I thought that's what he was saying.
Originally posted by 0Megabyte:
Further, how do you tell the difference between the alleles that were there originally, and the ones that came later, due to later mutations, which we can and do witness in the world around us?
This isn't sarcastic, either! I'm honestly curious how this idea, if I'm understanding Resh right, would work...
quote:Technically, it's the difference between an evolutionary change that results in speciation and one that does not, but since multiple instances of the latter tend to result in the former, the distinction isn't particularly black and white.
Originally posted by scholar:
I am a little confused about exactly where the cutoff between micro and macroevolution lies.
quote:Yeah. That circularity is what I was wondering about.
The actual mutation rate was counted by the rate at which new colonies formed on antibiotic petri dishes (which would only happen when that colony acquired resistance). That's circular if you don't believe that the resistance developed because of mutations, of course.
quote:Hence the second paragraph of Shigosei's post.
Originally posted by mr_porteiro_head:
quote:Yeah. That circularity is what I was wondering about.
The actual mutation rate was counted by the rate at which new colonies formed on antibiotic petri dishes (which would only happen when that colony acquired resistance). That's circular if you don't believe that the resistance developed because of mutations, of course.![]()
quote:Sorry, I didn't mean to imply that you hadn't. But he did address your follow-up in that post.
Originally posted by mr_porteiro_head:
Yes, I read all of Shigosei's post.
quote:My church accepts evolution. I guess it must not be true. I'll look for a different theory, then.
Originally posted by BlueWizard:
Here's an interesting thought, in every scientific stand the church has taken over its many centuries of existence, has been consistently WRONG every time. I would say that is a pretty reliable track record, and can easily be applied to their stand on Evolution.
quote:It's the positions that churches have taken up in opposition to science that have been wrong. Nodding and saying "sure, why not" to a scientific theory is usually the safe way to go. If that's what your church does, then good!
My church accepts evolution. I guess it must not be true. I'll look for a different theory, then.
quote:You really need to add a modifier between "the" and "church" since there are hundreds of different churchs in the world and many of them don't fit the description you give.
Originally posted by BlueWizard:
Here's an interesting thought, in every scientific stand the church has taken over its many centuries of existence, has been consistently WRONG every time.
quote:I think that the problem with this statement is that no person is only a "theologian" or only a "scientist". As people, we all play many rolls. There are even some out there who are both "theologians" and "scientists". I think what Dana was actually saying (and feel free to correct me if I'm wrong), was that when people try to draw conclusions about science based on theological reasons or conclusions about theology based on scientific reasons they tend to make asses of themselves.
Originally posted by dkw:
When theologians make pronouncements about science they tend to make incredible asses of themselves. Likewise when scientists make pronouncements about God or religion.
quote:I think that what IDers are doing (and I guess that's what I am, but I'm not a scientist) are trying to reset the rules of what actually count as science. They're saying that although the current state of scientific inquiry dictates that only Naturalistic mechanisms are admissible as evidence, this does not mean that only Naturalistic causes are possible. They would like to change the ground rules of science to allow for other possibilities.
Originally posted by scholar:
I hate to tell this anecdote since it is the exception and not the rule, but it relates. One of the science profs was given an hour to talk about whatever he wanted. A large part of it was about idiots who believe in religion. He went on to claim that within 50 years, science will have proven that man does not have souls and God cannot exist. I thought he was a raving idiot, but other people seemed to find him interesting. Most of the scientists I know are respectful of religion though and many attend church regularly. Most do find IDers annoying though (but would be ok if IDers stopped claiming ID to be a science).
quote:But science is something very specific and ID doesn't qualify and it's disingenuous to teach it in a science classroom as if it meets those rigourous standards.
Originally posted by Reshpeckobiggle:
quote:I think that what IDers are doing (and I guess that's what I am, but I'm not a scientist) are trying to reset the rules of what actually count as science. They're saying that although the current state of scientific inquiry dictates that only Naturalistic mechanisms are admissible as evidence, this does not mean that only Naturalistic causes are possible. They would like to change the ground rules of science to allow for other possibilities.
Originally posted by scholar:
I hate to tell this anecdote since it is the exception and not the rule, but it relates. One of the science profs was given an hour to talk about whatever he wanted. A large part of it was about idiots who believe in religion. He went on to claim that within 50 years, science will have proven that man does not have souls and God cannot exist. I thought he was a raving idiot, but other people seemed to find him interesting. Most of the scientists I know are respectful of religion though and many attend church regularly. Most do find IDers annoying though (but would be ok if IDers stopped claiming ID to be a science).
I mean, if you think about it, "science" is just a human concept, it's not an objective thing that we are tapping into. If everyone decided that science was something else, then that something else is what science would be, right?
quote:By their own admission they wanted to use a definition of science that would accept astrology as being scientific.
I think that what IDers are doing (and I guess that's what I am, but I'm not a scientist) are trying to reset the rules of what actually count as science.
quote:
Originally posted by Reshpeckobiggle:
To clarify the point of confusion, I was talking about the gene pool of Finches (and any other species group) in general. If all finches came from a single parental pair (as, I believe, both Evolution and the Bible would have you believe)
quote:
then what you guys are saying is that all the varieties of beak sizes are not possible within that gene pool and would only be possible from mutations.
quote:
If this is true, then as far as I understand
quote:
if you were to remove a male/female pair from the parent population and they both had very small beaks, it would require some mutation in order for any of their offspring to acquire beaks as large as might be found in the parent population. Do correct me if I'm wrong.
quote:
However, without invoking any hypothetical mutations, is it possible for a single male/female pair of a species to hold between them all the genetic material necessary to account for all the variations that are found within that species?
quote:
For example, is it possible that an original pair of dogs could have accounted for all the applied variations within the species, without mutations?
quote:
Secondly, and I don't even know if that's a good question, but I'm asking it, but if mutations are required, are degrading mutations sufficient?
quote:I have to say that I don't understand this argument. For one thing, that's not the definition of "tautology". But more importantly, why would tautologies and other self-evidently true things contain no explanatory power? Before that is explaned, I don't see the point of going further along this line of argument. I'd say self-evident things DO often have explanatory power.
Natural selection is a tautology because it is self-evidently true. It also, by virtue of being a tautology, contains exactly *zero* explanatory power.
quote:Tons of stuff that is taught in science classrooms is not, strictly speaking, science. For instance, we studied how the proponents of the heliocentric model of the solar system were persecuted by the church when I took science in high school. That is pretty clearly history - not science - but it was still taught in the science classroom, and I don't think anybody was confused by the notion that all sorts of science-related things can be discussed in science class.
But science is something very specific and ID doesn't qualify and it's disingenuous to teach it in a science classroom as if it meets those rigourous standards.
quote:True, but the history behind an idea, while anecdotal, is useful for explaining where an idea came from and how it's been accepted over time. People who have been promoting ID have largely promoted it as science or an "alternative" theory to evolution. There's a big difference between anecdotal information and theology being taught as science.
Tons of stuff that is taught in science classrooms is not, strictly speaking, science. For instance, we studied how the proponents of the heliocentric model of the solar system were persecuted by the church when I took science in high school. That is pretty clearly history - not science - but it was still taught in the science classroom, and I don't think anybody was confused by the notion that all sorts of science-related things can be discussed in science class.
quote:Yeah, but Tres, it's taught as an outmoded and ultimately false view of the universe and explaining how our understanding of the universe progressed from geocentric to heliocentric has numerous lessons pertinent to science.
Originally posted by Tresopax:
quote:I have to say that I don't understand this argument. For one thing, that's not the definition of "tautology". But more importantly, why would tautologies and other self-evidently true things contain no explanatory power? Before that is explaned, I don't see the point of going further along this line of argument. I'd say self-evident things DO often have explanatory power.
Natural selection is a tautology because it is self-evidently true. It also, by virtue of being a tautology, contains exactly *zero* explanatory power.
quote:Tons of stuff that is taught in science classrooms is not, strictly speaking, science. For instance, we studied how the proponents of the heliocentric model of the solar system were persecuted by the church when I took science in high school. That is pretty clearly history - not science - but it was still taught in the science classroom, and I don't think anybody was confused by the notion that all sorts of science-related things can be discussed in science class.
But science is something very specific and ID doesn't qualify and it's disingenuous to teach it in a science classroom as if it meets those rigourous standards.
quote:Its not necessarily that simple be because beak size isn't the result of only one gene and many characteristics are recessive. A bird can carry genes needed for big beaks but not necessarily have a big beak. Lets pick a simply example. Blue eyes are a recessive trait so if someone has blue eyes they can't carry the gene for brown eyes. So if we were separate people with blue eyes from the rest of the population and only allow blue eyed people to mate with blue eyed people, they would never have any brown eyed children unless there were mutations.
Originally posted by Reshpeckobiggle:
[QB]If this is true, then as far as I understand if you were to remove a male/female pair from the parent population and they both had very small beaks, it would require some mutation in order for any of their offspring to acquire beaks as large as might be found in the parent population. Do correct me if I'm wrong.
quote:No this isn't possible. Each individual contains only two copies of each gene. A single mating pair can carry at most 4 variants of a given gene. We know that within humans there are hundred and sometimes thousands of variants for different genes.
However, without invoking any hypothetical mutations, is it possible for a single male/female pair of a species to hold between them all the genetic material necessary to account for all the variations that are found within that species? For example, is it possible that an original pair of dogs could have accounted for all the applied variations within the species, without mutations?
quote:This isn't a distinction that is commonly made. The Most mutations don't either take away data from the DNA or add it. (Although mutations of that nature do occaasionally happen). Most mutation change the DNA sequence. If the DNA were a piece of text, most mutations would neither add lines nor delete lines, they would change some letter in the text. When scientists compare the genes for two individuals, they look at how many letters in the gene are different.
Secondly, and I don't even know if that's a good question, but I'm asking it, but if mutations are required, are degrading mutations sufficient? In other words, if you had a hypothetical perfect pair of a species, would all the variation that you find in that species require at least one -I don't know how this would be phrased- improving mutations, or mutations that add data to the genes? Or would mutations that only take away data from the DNA do all that was required to explain the variations?
quote:
Originally posted by Reshpeckobiggle:
The process they are akin to is a process that is required to explain large changes over time that have resisted detection in the fossil record.
quote:Man, you're running out of quips that don't make you sound purposefully ignorant :/
That was a long post of swbarnes, but I didn't read any of it. If he had anything interesting to say could someone bring it up?
quote:This isn't true. For instance, I was taught in middle school science class that electrons were little balls of mass that traveled in defined circular paths around the nucleus of an atom. This has long been contradicted by the scientific method, yet it was nevertheless taught to me as if it was scientific fact.
What we DON'T teach in science classrooms, though, are anti-scientific ideas, or ideas that are contradicted by the scientific method, as if they are science.
quote:But it is still history being taught in a science class, thus demonstrating that it is definitely NOT true that only claims within the strictly defined bounds of science are discussed in science classes. We also extensively discussed math in science class - that too is not something derived from the scientific method.
Yeah, but Tres, it's taught as an outmoded and ultimately false view of the universe and explaining how our understanding of the universe progressed from geocentric to heliocentric has numerous lessons pertinent to science.
quote:Being self-evident is never enough to make something a tautology, though. That's not what a tautology is.
Tresopax, I know what the definition of a tautology is. I was alluding to the idea (perhaps not necessarily true) that something that is a tautology may be so by mere virtue of the fact that it is self-evidently true, and one cannot desrcibe what that something is without formulating a tautology. By that reasoning, natural selection is a tautology by the strength of its "self-evident-ness."
quote:- - - emphasis added - - -
Originally posted by Tresopax:
There are many self-evident claims that are not tautologies. For instance, "IF God is perfectly good THEN God would only do good things" is self-evidently true, but it is not a tautology because the logic is "IF a THEN b" which is not always true.
quote:Then your science teacher was at fault. Because that is scientific theory. And any good science teacher, or at least the text book, should explain that what is taught in science classes are the best theories we have given the evidence, not facts that are absolutely true and can never be changed.
This isn't true. For instance, I was taught in middle school science class that electrons were little balls of mass that traveled in defined circular paths around the nucleus of an atom. This has long been contradicted by the scientific method, yet it was nevertheless taught to me as if it was scientific fact.
quote:That wasn't true either though - it wasn't even the best theory science had at the time. In fact, it was completely disproven, at the time they taught it to us. They already knew that electrons were not solid spheres that traveled in defined circular paths.
And any good science teacher, or at least the text book, should explain that what is taught in science classes are the best theories we have given the evidence, not facts that are absolutely true and can never be changed.
quote:I don't agree that "perfectly good" = "only doing good things". For instance, it is possible to be imperfect (or even evil) but somehow still end up only doing good things, by accident.
You went too far with this example. By many definitions of "perfectly good" and "only do good things", the two are the same. I mean they DO mean virtually the same thing. So you're saying "IF a THEN a", which is a tautology.
quote:You can always twist definitions like that. I did say that they were virtually the same.
Originally posted by Tresopax:
I don't agree that "perfectly good" = "only doing good things". For instance, it is possible to be imperfect (or even evil) but somehow still end up only doing good things, by accident.
quote:I agree with Tresopax on this example. You say that his two statements mean "virtually the same thing" but even if we grant that they do then it is still not a tautology. "IF virtually a THEN a" is NOT a tautology, "meaning virtually the same thing" is different from being the same thing for logical construction purposes.
You went too far with this example. By many definitions of "perfectly good" and "only do good things", the two are the same. I mean they DO mean virtually the same thing. So you're saying "IF a THEN a", which is a tautology.
quote:Fair enough. It is not a tautology. My point was closer to: this is virtually a tautology. Tresopax gave a nice Logical explanation, but then “ruined” it with an ambiguous example. IMO.
Originally posted by Enigmatic:
You say that his two statements mean "virtually the same thing" but even if we grant that they do then it is still not a tautology. "IF virtually a THEN a" is NOT a tautology, "meaning virtually the same thing" is different from being the same thing for logical construction purposes.
quote:I'm really not at all okay with this notion. Science should be taught incorrectly because some people assume that it's the only way to make it understood to some audiences?
The reason they taught it to us was because the science teachers wisely realized that 12-year-olds would not understand the concept of electrons if they tried to explain actual quantum mechanics in middle school. We needed to be able to think of electrons in a more concrete way, even though electrons weren't really the way we were taught to think of them.
My point here is that science class is not sacred. There is no rule that we must strictly limit what is taught in a science classroom in any way. What really matters is that the students end up understanding what they need to.
Now.... whether Intelligent Design is something students need to understand is debateable. But, if your argument is that it shouldn't be in classrooms, one should not assert the reason is because "only correct science belongs in science class". That premise just isn't true. At least some nonscience belongs in science class - and possibly even some false science too.
quote:This is an important distinction. Newtonian physics may be "wrong," insofar as we have since figured out that reality is more complex than his three laws, and that at certain scales those laws no longer provide sufficient accuracy. However, Newtonian physics as a model (i.e. as a theory) is still commonly used for everyday applications like architecture and industrial design, because the theory sufficiently approximates reality at that level.
Originally posted by suminonA:
Wait, why do we have to go to the extremes ? “Simplifying” is not equivalent with “incorrect”.
I mean, is Newton’s Mechanics INCORRECT? We know Einstein got it better, but the “basic” form (or rather the “particular case”) is not to be thrown out (from the class room).
The same with the “planetary system” model of the atom. It is a model. It is a simplified model. Why would presenting it as such be wrong?
A.
quote:I beg to disagree. The Bohr model of the atom (planetary model), although much simpler than the full quantum mechanics model, is neither falsified nor wrong. It is generally considered obsolete but it is worth mentioning that this simplified model is still used in X-ray and Auger spectroscopy because it is accurate enough for most applications.
Unlike Newtonian physics, the electrons-as-orbiting-particles model is just plain wrong, period. It has been falsified completely, and again unlike Newtonian physics, cannot even be used in lieu of the more complex orbital model in "simpler" applications. In suminonA's words, this isn't a simplification- it's incorrect.
quote:Yes. Thank you. Thank you for adding to this. You use the Bohr model as a simplified model for things like, say, demonstrating chemical relationships in a visual format. It does not come accompanied inherently with misinformation, nor should it. You can demonstrate a valence shell with a line without teaching anyone that it's like a 'planetary orbit' of an electron 'planet' or anything like that.
I agree with Samprimary that Tresopax's example is actually a case of science taught badly, rather than "teachers wisely realiz[ing] that 12-year-olds would not understand the concept of electrons if they tried to explain actual quantum mechanics in middle school." Unlike Newtonian physics, the electrons-as-orbiting-particles model is just plain wrong, period. It has been falsified completely, and again unlike Newtonian physics, cannot even be used in lieu of the more complex orbital model in "simpler" applications. In suminonA's words, this isn't a simplification- it's incorrect.
quote:My bad. It's been a long while since I took basic chemistry, and I know next to nothing about physics. Still, it should be pointed out that this only further supports the idea that even obsolete scientific theories have more predictive value than non-scientific pseudotheories like intelligent design.
Originally posted by The Rabbit:
quote:I beg to disagree. The Bohr model of the atom (planetary model), although much simpler than the full quantum mechanics model, is neither falsified nor wrong. It is generally considered obsolete but it is worth mentioning that this simplified model is still used in X-ray and Auger spectroscopy because it is accurate enough for most applications.
Unlike Newtonian physics, the electrons-as-orbiting-particles model is just plain wrong, period. It has been falsified completely, and again unlike Newtonian physics, cannot even be used in lieu of the more complex orbital model in "simpler" applications. In suminonA's words, this isn't a simplification- it's incorrect.
quote:*shrug* It was unnecessary, if you ask me, but whatever. I have no desire to turn Junior Mod like Resh, so let me restate my apologies for my factual error. Shall we move on with our lives?
Yes. Thank you. Thank you for adding to this.
quote:Oh, damn. In that case, egg on my face and foot crammed solidly in my mouth. Sorry, Samp.
Originally posted by Samprimary:
I try to thank people when they state portions of things I would like to have stated but didn't or couldn't as well and it's all serious and a 100% offhand 'thanks' -- I'm really actually seriously thanking you and continuing on your point!
code:Once the primers are on, an enzyme called polymerase moves along each single strand, adding the proper complementary nucleotides to the end of the growing strand as it moves. Polymerase needs the primer to get started.Double stranded DNA:
AGGCCGTTGAGAGTAGCATCTCCTC
TCCGGCAACTCTCATCGTAGAGGAG
Separated:
AGGCCGTTGAGAGTAGCATCTCCTC
TCCGGCAACTCTCATCGTAGAGGAG
With primers added:
AGGCCGTTGAGAGTAGCATCTCCTC
TCCGGCAA
TCTCCTC
TCCGGCAACTCTCATCGTAGAGGAG
quote:I didn't respond to this when it was posted because I thought the thread would progress faster than it has. But since things are pretty quiet...
Originally posted by Reshpeckobiggle:
You already lost me.
quote:*high-fives*
Originally posted by MattP:
A very long time ago. Class of '91.
quote:
RESH: I'm going to be expected to learn some serious biochemical theory here,
quote:
I know little more about biology than what I learned in my high school class over a decade ago, but Shigosei's explanation was easy to follow.
quote:
Resh, perhaps it would be a good idea to learn a little bit about the basics of molecular biology. We can help you.
quote:
do you really care to understand these intricacies?
quote:
I am not saying this to be insulting but I have not had to teach PCR to my new undergrads for several years. They have all done PCR experiments in high school biology (my latest two have actually successfully cloned genes in high school-one is business and the other undecided). When you say a degree in biology, this is not the expectation. The expectation is a high school degree. I know that the weakness in your education may not be your fault, but it is now up to you to remedy this.
quote:
I do not think it is unreasonable to assume a high school level understanding of a concept in a debate.
quote:
This isn't anything complex, this is a few weeks worth of high school biology
quote:
. Most of us are just recalling the biology we learned in high school and possibly college, and what we've picked up based on reading.
quote:.
It isn't that complex.
quote:
RESH: If no one cares to put much effort into their responses because they do not wish to argue with a layman, then they can go on talking each other with the knowledge that only they can understand
quote:
I know that the weakness in your education may not be your fault, but it is now up to you to remedy this.
quote:
I know people on this board would be more than willing to answer questions for you and there are a lot of resources out there.
quote:
Most of us are laymen.
quote:
We are not unwilling to argue with a layman.
quote:
We can help you.
quote:
If you don't know, that's fine -- you can either look things up or you can ask me questions if you don't know what a word means or you're confused about something.
quote:
We can help you.
quote:
We can help you.
quote:.
We can help you.
quote:
RESH: I'm really not prepared
quote:Eh, they're the children of a later, decadent age. The class of '90 represents the apex of civilization.
Originally posted by 0Megabyte:
Darned old people. Class of 91, for goodness' sake...